Меню Рубрики

Расшифровка анализа крови вск

Благодаря крови осуществляется большое количество жизненно необходимых процессов в организме. Она транспортирует питательные вещества, соединения кислорода, сохраняет температуру тела, предотвращает кровотечения и выполняет другие важные функции. Для определения способности крови образовывать сгустки проводят анализ на коагуляцию или свертываемость. Исследование свертывающей системы осуществляется в рамках биохимического анализа, которое называется коагулограмма.

Свертываемость (коагуляция) – важный этап функционирования системы гемостаза, обеспечивающий прекращение кровопотери при нарушении целостности сосудистой системы. Сворачивается кровь благодаря специальному белку фибрину, который непосредственно участвует в формировании тромбов (сгустков). При правильном функционировании свертывающей системы во время повреждения сосуда незамедлительно активизируется процесс образования тромбов, которые перекрывают повреждение и предотвращают кровопотерю.

Процесс коагуляции регулируется эндокринной и нервной системами. Благодаря жидкому состоянию крови, клетки без затруднений передвигаются по сосудам и выполняют основные функции. Анализ на свертываемость крови предполагает изучение как свертывающей функции, так и противосвертывающей. Сбалансированность между жидким состоянием и образованием тромбов обеспечивает правильное функционирование гемостаза. Анализ на свертываемость крови нужно сдавать в обязательном порядке при наличии следующих показаний:

  • патологии печени;
  • варикоз;
  • аутоиммунные патологии;
  • заболеваний сердечно-сосудистой системы;
  • беременность;
  • прием антикоагулянтов;
  • переизбыток гепарина;
  • нарушенный обмен белков;
  • онкологические поражения;
  • лейкоз;
  • хронический панкреатит;
  • генетические нарушения процесса выработки фибриногена;
  • ДВС-синдром (диссеминированное внутрисосудистое свёртывание).

При нарушениях в процессе коагуляции могут возникнуть серьезные патологии (тромбоз, инфаркт, инсульт). Заболевания опасны для жизни, если не оказать незамедлительную помощь. Также исследование крови на свертываемость обязательно делается при подготовке к оперативному лечению, а также во время восстановления после него.

Ранее для точного определения свертываемости крови использовали больше тридцати методик. На данный момент применяют два основных способа: метод Сухарева и Ли-Уайта. Кровь на свертываемость по методу Сухарева берут из пальца, а при способе Ли-Уайта сдавать кровь нужно из вены. Рассматривая нормы показателей важно учитывать, что допустимы небольшие отличия в зависимости от лаборатории и применяемых методик. В рамках анализа крови на свертываемость исследуют следующие показатели:

  1. Время свертываемости (ВСК) – в норме составляет от 5 до 10 минут для крови, взятой из вены; для капиллярной – 2 минуты. Согласно методу Сухарева начало свертывания должно начаться через промежуток от 30 секунд до 2 минут, а завершиться спустя 3-5 минут. ВСК по способу Сухарева отличается по причине того, что используется капиллярная кровь.
  2. АЧТВ (Активированное частичное тромбопластиновое время) – показатель используется для измерения внутреннего и общего пути свертывания, нормальное значение составляет от 25 до 39 секунд.
  3. ПТИ, обозначение расшифровывается как протромбиновый индекс – это соотношение ПТВ контрольной плазмы к аналогичному показателю плазмы пациента, выраженное в процентах. Норма показателя от 95 до 105%.
  4. ПТВ (протромбиновое время) – длительность образования тромба в плазме, нормальное значение от 11 до 16 секунд.
  5. МНО (международное нормализованное отношение) — соотношение ПТВ пациента к нормативному ПТВ, за норму принимают значение от 0,85 до 1,35%.
  6. Фибриноген – специфический белок плазмы крови. Нормальное значение находится в границах от 2 до 4 г/л для взрослых людей и от 1,25 до 3 г/л в детском возрасте.
  7. Тромбиновое время (ТВ) – исследуют для оценки конечной стадии свертываемости. Норма показателя от 14 до 21 секунды.
  8. Время рекальцификации плазмы (ВРП) – показывает, сколько времени требуется для образования тромба в плазме. Нормальное значение от 1 до 2 минут.
  9. Толерантность плазмы к гепарину – при тесте оценивают функционирование свертывающей системы полностью. Служит косвенным показателем уровня тромбина. Норма результата теста от 3 до 11 минут.
  10. Ретракция кровяного сгустка – завершающий этап образования тромба. В норме составляет от 44 до 65%.

При расшифровке теста на свертываемость у беременных за норму принимают иные значения. Контроль системы гемостаза необходим для исключения кровотечения во время родов. Нормы у беременных при проведении гемотеста составляют: АЧТВ – длительность от 17 до 20 секунд, фибриноген – менее 6,5 г/л, уровень тромбоцитов – от 131 до 402 тысяч на микролитр, протромбин – от 78 до 142%, ТВ – от 18 до 25 секунд.

Расшифровка результатов теста на свертываемость позволяет определить причину отклонения в системе гемостаза и назначить соответствующее лечение. Если показатель ВСК выше нормативного значения, то это свидетельствует о снижении коагуляции. Причиной может быть терапия коагулянтами, патологии печени или гемофилия. ВСК снижается после обильных кровопотерь либо при приеме противозачаточных средств.

Повышенное значение АЧТВ отмечается при недостаточном количестве витамина К, патологиях печени. Уменьшение происходит при гемофилии.

Если при расшифровке результатов теста определен повышенный уровень ПТИ, то это указывает на риск развития тромбоза. Росту способствует прием противозачаточных средств, малое количество употребляемой жидкости, также повышение возможно в третьем триместре беременности. Снижается ПТИ при недостатке витамина К, дисбактериозе, энтероколите, в результате приема диуретиков и ацетилсалициловой кислоты в больших дозировках. Уменьшение ТВ отмечается при переизбытке фибриногена, а увеличение происходит при нарушениях в функционировании печени или врожденных патологиях выработки фибрина.

Уменьшение количества фибриногена по результатам теста определяется при циррозном поражении печени, гепатите, патологических нарушениях ВСК, ДВС-синдроме, недостаточном количестве витаминов В12 и С, токсикозе в период беременности. Рост фибриногена происходит при воспалениях и инфицировании организма, пневмонии, обширных ожоговых поражениях, инфаркте миокарда, после оперативного лечения. Во время беременности важно регулярно проводить тесты на коагуляцию крови, так как отделение плаценты во время родовой деятельности может спровоцировать обильные кровотечения. Особое внимание нужно уделять показателю ВСК.

Некоторые нарушения в процессе коагуляции можно заподозрить по определенным симптомам. При увеличении ВСК кровь долгое время не останавливается при бытовых порезах и повреждениях. Появляются синяки и подкожные гематомы. Отмечаются кровотечения из носа и обильные менструации у женщин. Как правило, одновременно с отклонением ВСК происходит изменение и других показателей коагуляции. Патологии коагуляции крови могут повлечь серьезные осложнения. При первых признаках нарушения нужно обратиться к врачу и проверить значение показателей крови на свертываемость.

источник

Благодаря крови осуществляется большое количество жизненно необходимых процессов в организме. Она транспортирует питательные вещества, соединения кислорода, сохраняет температуру тела, предотвращает кровотечения и выполняет другие важные функции. Для определения способности крови образовывать сгустки проводят анализ на коагуляцию или свертываемость. Исследование свертывающей системы осуществляется в рамках биохимического анализа, которое называется коагулограмма.

Свертываемость (коагуляция) – важный этап функционирования системы гемостаза, обеспечивающий прекращение кровопотери при нарушении целостности сосудистой системы. Сворачивается кровь благодаря специальному белку фибрину, который непосредственно участвует в формировании тромбов (сгустков). При правильном функционировании свертывающей системы во время повреждения сосуда незамедлительно активизируется процесс образования тромбов, которые перекрывают повреждение и предотвращают кровопотерю.

Процесс коагуляции регулируется эндокринной и нервной системами. Благодаря жидкому состоянию крови, клетки без затруднений передвигаются по сосудам и выполняют основные функции. Анализ на свертываемость крови предполагает изучение как свертывающей функции, так и противосвертывающей. Сбалансированность между жидким состоянием и образованием тромбов обеспечивает правильное функционирование гемостаза. Анализ на свертываемость крови нужно сдавать в обязательном порядке при наличии следующих показаний:

  • патологии печени;
  • варикоз;
  • аутоиммунные патологии;
  • заболеваний сердечно-сосудистой системы;
  • беременность;
  • прием антикоагулянтов;
  • переизбыток гепарина;
  • нарушенный обмен белков;
  • онкологические поражения;
  • лейкоз;
  • хронический панкреатит;
  • генетические нарушения процесса выработки фибриногена;
  • ДВС-синдром (диссеминированное внутрисосудистое свёртывание).

При нарушениях в процессе коагуляции могут возникнуть серьезные патологии (тромбоз, инфаркт, инсульт). Заболевания опасны для жизни, если не оказать незамедлительную помощь. Также исследование крови на свертываемость обязательно делается при подготовке к оперативному лечению, а также во время восстановления после него.

Ранее для точного определения свертываемости крови использовали больше тридцати методик. На данный момент применяют два основных способа: метод Сухарева и Ли-Уайта. Кровь на свертываемость по методу Сухарева берут из пальца, а при способе Ли-Уайта сдавать кровь нужно из вены. Рассматривая нормы показателей важно учитывать, что допустимы небольшие отличия в зависимости от лаборатории и применяемых методик. В рамках анализа крови на свертываемость исследуют следующие показатели:

  1. Время свертываемости (ВСК) – в норме составляет от 5 до 10 минут для крови, взятой из вены; для капиллярной – 2 минуты. Согласно методу Сухарева начало свертывания должно начаться через промежуток от 30 секунд до 2 минут, а завершиться спустя 3-5 минут. ВСК по способу Сухарева отличается по причине того, что используется капиллярная кровь.
  2. АЧТВ (Активированное частичное тромбопластиновое время) – показатель используется для измерения внутреннего и общего пути свертывания, нормальное значение составляет от 25 до 39 секунд.
  3. ПТИ, обозначение расшифровывается как протромбиновый индекс – это соотношение ПТВ контрольной плазмы к аналогичному показателю плазмы пациента, выраженное в процентах. Норма показателя от 95 до 105%.
  4. ПТВ (протромбиновое время) – длительность образования тромба в плазме, нормальное значение от 11 до 16 секунд.
  5. МНО (международное нормализованное отношение) — соотношение ПТВ пациента к нормативному ПТВ, за норму принимают значение от 0,85 до 1,35%.
  6. Фибриноген – специфический белок плазмы крови. Нормальное значение находится в границах от 2 до 4 г/л для взрослых людей и от 1,25 до 3 г/л в детском возрасте.
  7. Тромбиновое время (ТВ) – исследуют для оценки конечной стадии свертываемости. Норма показателя от 14 до 21 секунды.
  8. Время рекальцификации плазмы (ВРП) – показывает, сколько времени требуется для образования тромба в плазме. Нормальное значение от 1 до 2 минут.
  9. Толерантность плазмы к гепарину – при тесте оценивают функционирование свертывающей системы полностью. Служит косвенным показателем уровня тромбина. Норма результата теста от 3 до 11 минут.
  10. Ретракция кровяного сгустка – завершающий этап образования тромба. В норме составляет от 44 до 65%.

При расшифровке теста на свертываемость у беременных за норму принимают иные значения. Контроль системы гемостаза необходим для исключения кровотечения во время родов. Нормы у беременных при проведении гемотеста составляют: АЧТВ – длительность от 17 до 20 секунд, фибриноген – менее 6,5 г/л, уровень тромбоцитов – от 131 до 402 тысяч на микролитр, протромбин – от 78 до 142%, ТВ – от 18 до 25 секунд.

Расшифровка результатов теста на свертываемость позволяет определить причину отклонения в системе гемостаза и назначить соответствующее лечение. Если показатель ВСК выше нормативного значения, то это свидетельствует о снижении коагуляции. Причиной может быть терапия коагулянтами, патологии печени или гемофилия. ВСК снижается после обильных кровопотерь либо при приеме противозачаточных средств.

Повышенное значение АЧТВ отмечается при недостаточном количестве витамина К, патологиях печени. Уменьшение происходит при гемофилии.

Если при расшифровке результатов теста определен повышенный уровень ПТИ, то это указывает на риск развития тромбоза. Росту способствует прием противозачаточных средств, малое количество употребляемой жидкости, также повышение возможно в третьем триместре беременности. Снижается ПТИ при недостатке витамина К, дисбактериозе, энтероколите, в результате приема диуретиков и ацетилсалициловой кислоты в больших дозировках. Уменьшение ТВ отмечается при переизбытке фибриногена, а увеличение происходит при нарушениях в функционировании печени или врожденных патологиях выработки фибрина.

Уменьшение количества фибриногена по результатам теста определяется при циррозном поражении печени, гепатите, патологических нарушениях ВСК, ДВС-синдроме, недостаточном количестве витаминов В12 и С, токсикозе в период беременности. Рост фибриногена происходит при воспалениях и инфицировании организма, пневмонии, обширных ожоговых поражениях, инфаркте миокарда, после оперативного лечения. Во время беременности важно регулярно проводить тесты на коагуляцию крови, так как отделение плаценты во время родовой деятельности может спровоцировать обильные кровотечения. Особое внимание нужно уделять показателю ВСК.

Некоторые нарушения в процессе коагуляции можно заподозрить по определенным симптомам. При увеличении ВСК кровь долгое время не останавливается при бытовых порезах и повреждениях. Появляются синяки и подкожные гематомы. Отмечаются кровотечения из носа и обильные менструации у женщин. Как правило, одновременно с отклонением ВСК происходит изменение и других показателей коагуляции. Патологии коагуляции крови могут повлечь серьезные осложнения. При первых признаках нарушения нужно обратиться к врачу и проверить значение показателей крови на свертываемость.

Многие годы безуспешно боретесь с ГИПЕРТОНИЕЙ?

Глава Института: «Вы будете поражены, насколько просто можно вылечить гипертонию принимая каждый день.

ЭКГ и ЭхоКГ относятся к самым результативным обследованиям сердечно-сосудистой системы. Для них характерны совместные цели и задания. Но методы и способы, которые используются при их проведении, существенно отличаются друг от друга. В чем же разница между ЭхоКГ (УЗИ сердца) и ЭКГ и что дает каждое из этих исследований?

Способом проведения. Для снятия ЭКГ надо пользоваться кардиографом и электродами. При этом, происходит осмотр и фиксация электростатической деятельности мышцы сердца, а потом – перевод итогов в графический рисунок. На нем хорошо видно:

Для лечения гипертонии наши читатели успешно используют ReCardio. Видя, такую популярность этого средства мы решили предложить его и вашему вниманию.
Подробнее здесь…

  • характеризуется ли деятельность органа стабильным ритмом пульсации;
  • какими являются числовые показатели биения;
  • наличие или отсутствие аритмии.

Для проведения ЭхоКГ сердца необходимо особое электронное оборудование, которое называется преобразователем. Его необходимо плотно приложить к грудной клетке, а затем привести в рабочее состояние. Данное устройство является генератором волн, принадлежащих к ультразвуковому спектру. Они способны проникать внутрь органа, отбиваться от его тканей и возвращаться назад.

Особое оборудование способствует обработке принятых данных и выведению их на экран. При этом на его мониторе можно увидеть объемную картинку.

С помощью последнего, врачам удается устанавливать и предотвращать возникновение недостаточности органа, проверять деятельность клапана, определять местоположение атрофированных фракций мышцы сердца.

Эхокардиограмму используют для исследования состояния сердца больного, который перенес приступ, выявления серьезных сгустков крови, которые не движутся. Кроме этого, с помощью нынешних эхо-преобразователей можно изучать работу жизненно важного органа в 3D-изображении.

В сопоставлении с ЭКГ преобразователь способен обеспечить более понятную картину обследования, так как выявляет наличие практически всех заболеваний органа.

Эхокардиограмма имеет несколько видов, рассмотрим каждый в отдельности.

Стандартный вид эхокардиограммы, который характеризуется безболезненностью и чем-то похож на рентгенографию, с помощью этой процедуры проводят оценку состояния здоровья еще до появления на свет.

Для проведения этого вида ЭхоКГ датчик, который осуществляет передачу звуковых волн высокой частоты, прикладывают к груди. Сердечные мышцы отбивают эти волны. Таким образом происходит создание изображения и звуков, анализируя которые доктор определяет наличие или отсутствие аномалий и болезней органа.

При чреспищеводном ЭхоКГ датчик в виде глотательной трубы, соединяющей желудок с полостью рта, вводится в полость пищевода. Его тесное расположение к сердцу способствует получению отчетливого изображения строения органа.

Эхокардиограмма, которую проводят при нагрузочном тесте, используя добутамин или аденозин, относится к стрессовым ЭхоКГ. Только здесь применяется не физиологическая нагрузка на орган, а влияние медицинских препаратов, стимулирующих работу органа.

С помощью этого исследования можно оценивать то, в каком состоянии находится орган в том случае, когда отсутствует возможность использовать для этих целей дорожку или велосипед, переносимость нагрузок, возможность возникновения ишемической болезни, результативность проводимой терапии.

Во время спортивных занятий пациента с использованием дорожки для бега или велосипеда проводят стрессовую ЭхоКГ.

На протяжении этой процедуры можно визуализировать движения сердечных стенок и анализировать его насосное функционирование при увеличенных нагрузках на орган.

Читайте также:  Расшифровка анализа крови у собак таблица по породам

С помощью стрессовой эхокардиограммы, в отличие от других аналогичных исследований, можно определить недостаток кровяного тока.

К применению внутрисосудистого ультразвука прибегают при катетеризации сердца. При этом в полость кровеносных сосудов вводится специальный датчик. Для этого используется катетер.

В большинстве случаев эта процедура проводится для того, чтобы проанализировать закупорку внутри сосуда.

Эхокардиограммы бывают 3 типов:

  1. Одномерная в М-режиме – волна, подаваемая устройством, размещается вдоль одной оси. Поэтому на мониторе показан вид на орган сверху. При перемещении линии ультразвука можно осуществлять проверку желудочка, аорты и предсердия.
  2. Двухмерная эхокардиограмма способствует осмотру сердца в двух проекциях. Поэтому при ее проведении можно проводить анализ движения сердечных структур.
  3. Доплеровскую эхокардиограмму проводят для того, чтобы оценить такие параметры работы органа, как скорость, с которой движется кровь, и ее турбулентность. В результате принятых итогов можно сделать заключение о наличии пороков и степени наполнения желудочка.

Проводить ЭхоКГ надо обязательно при наличии таких симптомов:

  • болевых ощущений в грудях или сердце;
  • шумах и срывов ритма при деятельности органа;
  • ишемии или острого инфаркта миокарда;
  • симптомов, которые свидетельствуют о наличии сердечной недостаточности;
  • отдышки, стремительной утомляемости, дефицита воздуха, учащенных побледнений кожи.

Обязательно проводят процедуру ЭхоКГ больным, перенесшим операционное вмешательство на сердце, при травмированной грудной клетке. Также направление на УЗИ сердца могут получить те, кто имеет:

  • головные боли хронического характера;
  • искусственный клапан;
  • атеросклероз;
  • гипертоникам;
  • активно занимается спортом.

Подготовка к процедуре не характеризуется необычной сложностью. Пациент должен снять с себя одежду до пояса и лечь на левый бок. Такая поза обеспечивает самое близкое расположение грудной клетки к верхушке исследуемого органа. Это способствует получению максимально четкого изображения.

После этого места размещения датчиков смазываются с помощью геля. Их разнообразные позиции способствуют максимально наглядному определению сердечных отделов, а также замеру и фиксации результатов их деятельности.

Прикрепление этих датчиков не болезненное и не вызывает дискомфорт. Собственно, с их помощью и направляется ультразвук, видоизменяющийся во время прохождения через ткани, отражающийся и возвращающийся назад.

Затем происходит преобразование звуков в сигналы, что попадают в эхокардиограф. Звуковая волна меняется при воздействии модификаций состояния органов.

После обработки сигналов на мониторе появляется четкая картинка, согласно которой врач делает соответствующие заключения о состоянии пациента.

О том, как делают УЗИ сердца, узнайте из видео:

Продолжением эхокардиографического исследования является расшифровка его результатов. Точно и всестороннее проанализировать их может только врач-кардиолог.

В любом заключении проведения ультразвукового исследования имеются неизменные, константные параметры, которые характерны для нормального состоянии и функционирования органа. По их значениям и определяются особенности функционирования и структуры камер сердца. К ним относятся данные, характеризующие желудочки, межжелудковую перегородку, клапаны и перикард.

При проведении ЭхоГК задаются нормальные показатели деятельности желудочков. В зависимости от степени отклонения реальных результатов от этих показателей устанавливается развитие или наличие соответствующей патологии.

Более простой, в сравнении с параметрами желудочков, является расшифровка итогов обследований сердечных клапанов. В случае уклонения от нормы можно говорить о развитии либо недостаточности, либо стеноза. Сокращенный диаметр просвета, при котором существенно затрудняется перекачивание крови, свидетельствует о наличии стеноза.

Формирование недостаточности провоцирует несколько иной процесс: негерметично закрывающиеся створки способствуют возвращению крови обратно в камеру, что существенно снижает эффективность работы сердца.

Самой распространенной патологией перикарда является перикардит – скапливание жидкости между перикардом и миокардом, что существенно затрудняет деятельность органа.

Стоимость ЭхоКГ имеет очень широкий диапазон. На ее показатели очень влияет квалификация и репутация специалиста, который проводит данное исследование, а также уровень и расположение медицинского учреждения. Это обусловлено тем, что полностью и правильно расшифровать полученную информацию может только высококвалифицированный специалист.

А так как сердце является практически самым важным человеческим органом, который обеспечивает жизнедеятельность всему нашему организму – то и рисковать его состоянием не надо. Потому что очень часто это заканчивается летальным исходом.

способ ранней диагностики заболеваний, связанных с нарушением функционирования генетического аппарата клетки

Классы МПК: G01N33/48 биологических материалов, например крови, мочи; приборы для подсчета и измерения клеток крови (гемоцитометры)
C12Q1/68 использующие нуклеиновые кислоты
Автор(ы): Лактионов П.П. (RU) , Скворцова Т.Э. (RU) , Тамкович С.Н. (RU) , Рыкова Е.Ю. (RU) , Власов В.В. (RU)
Патентообладатель(и): Лактионов Павел Петрович (RU),
Власов Валентин Викторович (RU)
Приоритеты:

Изобретение относится к области диагностической медицины, а именно к разработке неинвазивных способов ранней диагностики различных заболеваний человека, в частности к выявлению ранних стадий рака, патологии беременности, а также мониторинга эффективности терапии. Сущность способа заключается в том, что после забора крови ее разделяют на плазму и фракцию клеток крови, затем фракцию клеток крови разделяют на эритроциты и лейкоциты, далее последовательно элюируют внеклеточные нуклеиновые кислоты, связанные с поверхностью эритроцитов и лейкоцитов, из полученных элюатов выделяют фракции внеклеточных нуклеиновых кислот и проводят амплификационный анализ не менее 2-х известных специфических последовательностей нуклеиновых кислот, ассоциированных с определенным заболеванием, с использованием соответствующего метода (полимеразная цепная реакция, лигазная цепная реакция, мультиплексная ПЦР и др.). Преимущество изобретения заключается в повышении точности диагностики. 5 з.п. ф-лы, 4 табл., 1 ил.

Изобретение относится к области диагностической медицины, а именно к разработке неинвазивных способов ранней диагностики различных заболеваний человека, в частности к выявлению предраковых состояний и ранних стадий рака, патологии беременности, а также мониторинга эффективности противораковой терапии.

Онкологические, аутоиммунные и наследственные болезни возникают вследствие нарушений функционирования генетического аппарата клетки. Способы, ориентированные на исследование нуклеиновых кислот (НК), таким образом, выявляют причину дисфункции и являются способами ранней диагностики, поскольку позволяют выявлять нарушения в функционировании генетического аппарата задолго до проявления клинических признаков заболевания.

Раннее выявление в крови специфических последовательностей нуклеиновых кислот, ассоциированных с различными заболеваниями, является важной проблемой в диагностической медицине. В то время как прямой анализ пораженных тканей бывает затруднен или недоступен (нет симптоматики), периферическая кровь является легкодоступным биологическим материалом для получения нуклеиновых кислот, которые могут быть использованы в амплификационном анализе.

Известен способ диагностики рака предстательной железы путем выявления мутантных генов раковых клеток методами ПЦР-анализа (1). Известно, что на поздних стадиях рака метастатические клетки циркулируют в крови, поэтому для анализа используют клеточную фракцию крови, из которой выделяют РНК одним из известных способов, а затем проводят мультиплексную ОТ-ПЦР. При раке предстательной железы у 84% пациентов (43/51) со злокачественной опухолью были выявлены значительные количества (3800 копий/0.5 мл крови) PSA и hK2 мРНК, тогда как лишь у одного из 19 пациентов (5%) с доброкачественной опухолью было обнаружено присутствие фрагментов PSA и hK2 мРНК в количестве 1500 и 3100 копий/0,5 мл крови. Главным недостатком этого способа является то, что требуется обязательное наличие метастатических, циркулирующих в крови больного раковых клеток (для негематологических опухолей), что ограничивает использование амплификационного анализа для больных в предраковом состоянии и с раком на начальной стадии.

Известно, что в плазме крови циркулируют нуклеиновые кислоты (2), количества которых в 10-100 раз выше у раковых больных (3, 4). При этом количество внеклеточных нуклеиновых кислот (ВНК) в плазме крови коррелирует со стадией развития рака и размером опухоли (5). На ранних стадиях возникновения рака количества ВНК в плазме относительно нормы практически не увеличиваются. Циркулирующие ВНК крови, выделенные из плазмы крови, используют для уточнения диагноза при онкологических, аутоиммунных и наследственных заболеваниях (6).

Известен способ диагностики онкозаболеваний путем выявления мутантных онкогенов ras в плазме периферической крови с помощью аллельспецифичной ПЦР с последующим секвенированием полученных фрагментов ДНК (7). Недостатками этого способа являются большая трудоемкость и длительность выделения ДНК, а также низкая достоверность результатов диагностики раковых и особенно предраковых состояний из-за небольшого удельного содержания специфических последовательностей НК, что затрудняет клиническое использование данного способа.

Известен способ диагностики преэклампсии путем оценки количества ВНК, циркулирующих в плазме беременных женщин, методами амплификации (8). Для анализа используют ДНК плазмы, выделенную любым известным способом, а затем проводят количественный ПЦР анализ. Недостатком данного способа является низкая достоверность результатов диагностики ранней патологии беременности.

Наиболее близким к заявленному способу — прототипом — является способ диагностики онкозаболеваний путем выявления онкоспецифических маркеров в плазме или сыворотке крови амплификационными методами (9), включающий следующие стадии: разделение крови на форменные элементы и плазму, выделение внеклеточной циркулирующей ДНК из плазмы сорбцией на мелкодисперсном стекле (ММС), выявление мутантной ДНК методами амплификационного анализа (полимеразная цепная реакция, лигазная цепная реакция, мультиплексная ПЦР и другие), с последующим анализом продуктов реакции и проведением, в случае необходимости, рестрикционного анализа.

Недостатком прототипа является низкая достоверность результатов диагностики ранних стадий онкозаболеваний, так как основная доля циркулирующих ВНК крови ассоциирована с клеточной поверхностью форменных элементов крови, что снижает удельное содержание специфических последовательностей НК в плазме и приводит к получению ложноотрицательных результатов.

Технической задачей изобретения является повышение достоверности ранней диагностики заболеваний, связанных с нарушением функционирования генетического аппарата клетки.

Поставленная техническая задача достигается предлагаемым способом, который заключается в следующем.

Производят забор крови, разделяют собранную кровь на плазму и фракцию клеток крови при помощи центрифугирования, затем фракцию клеток крови разделяют на эритроциты и лейкоциты при помощи центрифугирования в градиенте плотности. Далее элюируют ВНК, связанные с поверхностью эритроцитов в две стадии: сначала элюцию осуществляют 10 объемами фосфатного буферного раствора (ФБР), содержащего 5 мМ ЭДТА (этилендиаминтетрауксусная кислота) при 4°С, с последующим осаждением клеток центрифугированием и сбором супернатанта, а затем элюцию проводят равным объемом 0,25% раствора трипсина при 4°С, с последующим добавлением ингибитора фермента, осаждением клеток центрифугированием и сбором супернатанта. Элюцию ВНК, связанных с поверхностью лейкоцитов, также проводят в две стадии: сначала элюцию осуществляют 10 объемами ФБР, содержащим 5 мМ ЭДТА при 4°С, с последующим осаждением клеток центрифугированием и сбором супернатанта, а затем элюцию проводят равным объемом 0,125% раствора трипсина при 4°С, с последующим добавлением ингибитора фермента, осаждением клеток центрифугированием и сбором супернатанта.

Далее выделяют ВНК из полученных супернатантов (элюатов) и проводят амплификационный анализ не менее 2-х специфических последовательностей НК с использованием соответствующего метода (полимеразная цепная реакция, лигазная цепная реакция, мультиплексная ПЦР и другие).

Использование для анализа ВНК, связанных с поверхностью клеток крови, особенно эффективно для диагностики ранних стадий патогенеза, в частности рака, когда основная масса ВНК крови связана с клеточной поверхностью.

Определяющими отличительными признаками предлагаемого способа по сравнению с прототипом являются:

1. Использование в качестве диагностического объекта ВНК, связанных с поверхностью клеток крови (эритроцитов и лейкоцитов), что позволяет значительно повысить достоверность выявления специфических последовательностей НК на ранних стадиях заболеваний, связанных с нарушением функционирования генетического аппарата клетки, когда основная масса ВНК связана с клеточной поверхностью эритроцитов и лейкоцитов, а в плазме находятся лишь незначительные ее количества.

ВНК, связанные с поверхностью клеток крови, могут быть связаны с клеточной поверхностью в виде свободных НК, а также в составе комплексов с белками, липидами, липопротеинами (протеолипидами), в виде рибонуклеопротеиновых комплексов, нуклеосом и апоптических телец (10, 11). В прототипе анализируют специфические последовательности НК, выделенных из плазмы.

2. Разделение клеточной фракции крови на эритроциты и лейкоциты, что позволяет повысить достоверность диагностики за счет увеличения удельного содержания специфических последовательностей НК для дальнейшего амплификационного анализа.

3. Последовательная двухстадийная элюция ВНК с поверхности эритроцитов и лейкоцитов, что позволяет уменьшить количество балластных нуклеиновых кислот из нормальных клеток крови и увеличить удельное содержание выявляемых специфических последовательностей.

4. Проведение ПЦР-анализа не менее чем по двум известным специфическим последовательностям НК, вовлеченным в патогенез, и при их выявлении диагностирование наличия соответствующего заболевания.

Использование нового диагностического объекта — ВНК крови, связанных с клеточной поверхностью, позволяет увеличить чувствительность детекции специфических последовательностей ДНК и РНК за счет их повышенного удельного содержания на ранних стадиях патологенеза.

Изобретение иллюстрируется следующими примерами конкретного выполнения способа.

При проведении ежегодного обследования рабочих (производство плутония и, как следствие, риск онкозаболеваний дыхательных путей) в 1999 и 2000 годах были взяты образцы крови. Целью обследования было выявление среди рабочих с неопределенными хроническими заболеваниями легких (группа риска) профиля гиперметилирования генов (АРС и RASSF1A), вовлеченных в регуляцию онкообразований.

Взятую кровь, разделяли на плазму и фракцию клеток крови при помощи центрифугирования в течение 20 мин при 400 g, затем фракцию клеток крови разделяли на эритроциты и лейкоциты при помощи центрифугирования через среду для разделения лимфоцитов (Flow, USA) в течение 30 мин при 400 g. Далее элюировали ВНК, связанные с поверхностью эритроцитов в две стадии: сначала отмывали клетки добавлением 10 объемов ФБР, содержащего 5 мМ ЭДТА при 4°С, с последующим осаждением клеток центрифугированием и сбором супернатанта, а затем элюцию проводили равным объемом 0,25% раствора трипсина при 4°С, с последующим добавлением ингибитора фермента, осаждением клеток центрифугированием и сбором супернатанта. Элюцию ВНК, связанных с поверхностью лейкоцитов, также провели в две стадии: сначала элюировали ВНК 10 объемами ФБР, содержащего 5 мМ ЭДТА при 4°С, с последующим осаждением клеток центрифугированием и сбором супернатанта, а затем элюировали прочносвязанные ВНК равным объемом 0,125% раствора трипсина при 4°С, с последующим добавлением ингибитора фермента, осаждением клеток центрифугированием и сбором супернатанта.

ДНК выделяли из полученных элюатов, а также плазмы (для сравнения) методом сорбции на мелкодисперсном стекле (12). ДНК модифицировали обработкой бисульфитом натрия, при которой неметилированные цитозины в 5 положении превращаются в урацил (20 минут при 75°С в присутствии 3М NaOH; 4 часа при 56°С в присутствии Nа 2 S 2 О 5 ; 30 минут при 37°С в присутствии 3М NaOH).

После начальной термической обработки модифицированной ДНК в течение 5 минут при 95°С добавляли 1 ед. Taq ДНК полимеразы (производства Института Цитологии и Генетики СО РАН, Россия) и проводили 55 циклов полимеразной цепной реакции в следующем режиме:

— для гена АРС — 45 секунд при 95.5°С, 45 секунд при 64°С, 45 секунд при 72°С; были использованы праймеры (13):

метилированная пара — 5’-TATTGCGGAGTGCGGGTC-3’ (Пр1),

неметилированная пара — 5’-GTGTTATTGTGGAGTGTGGGTT-3’ (Пр1),

— для гена RASSF1A — 45 секунд при 95.5°С, 45 секунд при 64°С (для метелированной пары праймеров), 45 секунд при 59°С (для неметилированной пары праймеров), 45 секунд при 72°С; были использованы праймеры (14):

метилированная пара — 5’-GGGTTTTGCGAGAGCGCG-3’ (Пр1),

неметилированная пара — 5’-GGTTTTGTGAGAGTGTGTTTAG-3’ (Пр1),

После окончания 55 циклов полимеразной цепной реакции реакционную смесь инкубировали 5 минут при 72°С и охлаждали до 4°С.

Полученные данные представлены в табл.1, из которой видно, что метилированные маркеры АРС и RASSF1A, ассоциированные с легочным канцерогенезом, выявляются с большой частотой (до 50,04%) в элюатах ВПК, связанных с клеточной поверхностью, на ранней стадии заболевания (обследование 1999 г.), что позволило поставить предварительный диагноз. Через год при повторном обследовании более высокий процент гиперметилированных маркеров в группе риска (до 20,85%) выявлялся уже и в образцах плазмы, что объясняется уменьшением количества ВНК, связанных с клеточной поверхностью. В течение 5 лет с момента первого взятия крови у 60% пациентов из группы риска был клинически подтвержден рак легкого. У всех больных, показавших положительный профиль гиперметилирования, был диагностирован рак легкого. Наиболее эффективное выявление специфических последовательностей обнаружено во фракции, содержащей ВНК, элюированные с поверхности эритроцитов обработкой ФБР/ЭДТА.

Читайте также:  Таблица показателей анализа глюкозы в крови

Данный пример иллюстрирует, что заявляемый способ может быть использован для ранней диагностики рака легкого, что способствует своевременному выбору правильной стратегии лечения.

У группы женщин (N=32), успешно прооперированных два года назад по поводу раковой опухоли груди и прошедших курс химиотерапии, были взяты образцы крови с профилактической целью, так как пациентки с раком груди входят в группу онкобольных с высоким риском повторных новообразований. Выделение ВНК, циркулирующих в плазме (для сравнения) и связанных с поверхностью эритроцитов и лейкоцитов, проводили аналогично примеру 1.

Для оценки экспрессии онкогенов, имеющих важное прогностическое значение при раке груди, мультиплексный количественный ПЦР-анализ провели с использованием праймеров, специфичных для генов с-mус и с-еrbВ2.

Без предварительной термической денатурации в реакционную смесь добавляли 1 ед. Tfl ДНК полимеразы (производства Tpicentre Technologies) и проводили 30 циклов полимеразной цепной реакции в следующем режиме:

— для гена c-myc — 1 минута при 94°С, 1 минута при 65°С, 2 минуты при 72°С; были использованы праймеры (15):

— для гена c-erbB2 — 1 минута при 94°С, 1 минута при 56°С, 2 минуты при 72°С; были использованы праймеры (16):

После окончания 30 циклов ПЦР продукты были разделены в агарозном геле методом электрофореза, окрашены бромистым этидием и количественно оценены при помощи Системы Gel Doc 2000 (Bio-Rad) и компьютерной программы Quantity One (Bio-Rad).

Процент выявленной у пациенток (N=32) сверхэкспрессии исследованных генов представлен в табл.2

Таблица 2
Гены ДНК плазмы ДНК, связанная с клеточной поверхностью
Эритроциты Лейкоциты
с-mус 9% 9%
с-еrbВ2 9% 9%

Из табл.2 видно, что анализ ДНК, связанной с клеточной поверхностью, как эритроцитов, так и лейкоцитов, выявил сверхэкспрессию исследованных генов у 9% женщин (3/32), в то время как при анализе плазмы тех же пациенток были получены отрицательные результаты. В течение последующих двух лет у 9% пациенток были клинически диагностированы повторные метастазы в региональных лимфоузлах. При этом обнаружена одинаковая эффективность выявления специфических последовательностей из фракций, содержащих элюаты с поверхности и эритроцитов, и лейкоцитов.

Данный пример иллюстрирует, что разработанный способ может быть использован для оценки эффективности хирургического вмешательства и постоперационной терапии.

У 38 пациентов с подозрением на рак прямой кишки (группа риска) и у контрольной группы здоровых доноров были взяты образцы крови.

Выделение РНК, связанных с поверхностью эритроцитов и лейкоцитов, проводили аналогично примеру 1. Выявление двух маркерных последовательностей мРНК, цитокератина19 (СК19) и карциномоэмбрионального антигена (СЕА), проводили методом RT-PCR.

В реакционную смесь сразу добавляли 0,5 ед. Amply Taq Gold ДНК полимеразы и 3 ед. MultiScribe обратной транскриптазы (РЕ Diosystems, USA). Затем реакционную смесь последовательно инкубировали 12 минут при 42°С и денатурировали 9 минут при 95°С, после чего проводили 43 цикла (для СК19) и 40 циклов (для СЕА) полимеразной цепной реакции в следующих режимах:

— для гена СК19 — 30 секунд при 95°С, 30 секунд при 58°С, 1 минута при 72°С; были использованы праймеры (17):

— для гена СЕА — 30 секунд при 95°С, 30 секунд при 65°С, 1 минута при 72°С; были использованы праймеры (17):

После окончания 43(40) циклов полимеразной цепной реакции реакционную смесь инкубировали 11 минут при 72°С.

Далее ПЦР продукты были разделены в полиакриламидном геле методом электрофореза и оценены денситометрически при помощи Системы GS-690 Imaging Densitometry (Bio-Rad) и компьютерной программы Multi-Analyst/PC (Bio-Rad).

Полученные данные представлены в табл.3. Из табл.3 видно, что по результатам исследования ВНК, связанных с клеточной поверхностью, 60,53% предраковых пациентов имеют положительный результат хотя бы по одному из маркеров, в то же время в плазме выявляется только 26,31%. При этом более эффективное выявление специфических последовательностей обнаружено во фракции, содержащей ВНК, элюированные с поверхности эритроцитов.

Данный пример иллюстрирует, что разработанный способ может быть использован для диагностики онкозаболеваний на ранних стадиях.

У 32 женщин с преэклампсией были взяты образцы крови, 8 случаев были диагностированы как тяжелые. Для контроля были взяты пробы крови у женщин с нормально протекающей беременностью. Выделение ВНК, связанных с поверхностью эритроцитов и лейкоцитов, проводили аналогично примеру 1. Количественное определение (эквивалент генома на 1 мл крови) суммарной внеклеточной ДНК и мужской плодной внеклеточной ДНК, связанной с поверхностью клеток, проводили методом TaqMan real-time ПЦР с использованием праймеров, специфичных для генов SRY (локализация на Y-хромосоме) и GAPDH.

В реакционную смесь сразу добавлялась Amply Taq Gold ДНК полимераза (Perkin Eimer) из расчета 0, 025 ед. на 1 l и AmpErase урацил-N-гликозилаза (Perkin Eimer) из расчета 0,01 ед. на 1 l. Затем реакционную смесь последовательно инкубировали 2 минуты при 50°С и денатурировали 10 минут при 95°С, после чего для обоих генов проводили 40 циклов полимеразной цепной реакции в следующем режиме: 1 минута при 60°С и 15 секунд при 95°С; были использованы следующие праймеры и флуоресцентные зонды (8):

5’-(6-carboxyfluorescein; FAM) CACCAGCAGTAACTCCCCACAACCTCTTT (6-carboxytetramethylrhodamine; TAMPA)-3’ (зонд).

Полученные данные представлены в табл.4. Из табл.4 видно, что количества ДНК, связанной с клеточной поверхностью (как суммарной, так и плодной), в группе женщин с тяжелой преэклампсией повышены в 10 раз по сравнению с группой женщин, беременность которых протекает нормально.

Данный пример иллюстрирует, что разработанный способ может быть использован для оценки тяжести патологии беременности, уточнения диагноза и мониторинга эффективности терапии.

Использование предлагаемого способа позволит по сравнению с прототипом повысить достоверность ранней диагностики заболеваний, связанных с нарушением функционирования генетического аппарата клетки, за счет:

— уменьшения количества балластных нуклеиновых кислот из нормальных клеток крови;

— увеличения удельного содержания выявляемых специфических последовательностей ВНК, связанных с клеточной поверхностью, по сравнению с содержанием специфических последовательностей ВНК, выделенных из плазмы крови;

— увеличения чувствительности детекции специфических (маркерных) последовательностей ДНК и РНК, связанных с клеточной поверхностью эритроцитов и лейкоцитов, что особенно важно на ранних стадиях развития патологий, когда основная масса внеклеточных кислот связана с поверхностью клеток крови.

1. Ylikoski A, Pettersson К, Nurmi J, Irjala К, Karp M, Lilja H, Lovgren Т, Nurmi M. Simultaneous quantification of prostate-specific antigen and human glandular kallikrein 2 mRNA in blood samples from patients with prostate cancer and benign disease // Clin. Chem. 2002, V.48 (8): 1265-71.

2. Leon SA, Shapiro B, Sklaroff DM, Yaros MJ. Free DNA in the serum of cancer patients and the effect of therapy // Cancer Res. 1977, V.37 (3): 646-50.

3. Shapiro B, Chakrabarty M, Cohn EM, Leon SA. Determination of circulating DNA levels in patients with benign or malignant gastrointestinal disease // Cancer, V.51: 2116-20.

4. Stroun M, Anker P, Maurice P, Lyautey J, Lederrey С, Beljanski M. Neoplastic characteristics of the DNA found in the plasma of cancer patients // Oncology, 1989, V.6 (5): 318-22.

5. Sozzi G, Conte D, Mariani L, Lo Vullo S, Roz L, Lombardo C, Pierotti MA, Tavecchio L. Analysis of Circulating Tumor DNA in Plasma at Diagnosis and during Follow-Up of Lung Cancer Patients // Cancer Research. 2001, V.61 (15): 4675-4678.

6. Allan JM, Hardie LJ, Briggs JA, Davidson LA, Watson JP, Pearson SB, Muers MF, Wild CP. Genetic alterations in bronchial mucosa and plasma DNA from individuals at high risk of lung cancer // Int. J. Cancer, 2001, 91(3): 359-365.

7. Sorenson GD, Pribish DM, Valone FH, Memoli VA, Bzik DJ, Yao SL. Soluble normal and mutated DNA sequences from single-copy genes in human blood // Cancer Epidemiology, Biomarkers & Prevention, 1994, V.3: 67-71.

8. Zhong XZ, Lavuori H, Livingston JC, Ylikorkala O, Sibai BM, Holzgreve W, Hahn S. Elevation of maternal and fetal extracellular circulating deoxyribonucleic acid concentrations in the plasma of pregnant women with preeclampsia // Am. J. Obstet. Gynecol. 2001, V.184 (3): 414-419.

9. Kopreski MS, Benko FA, Borys DJ, Khan A, McGarrity TJ, Gocke CD. Somatic mutation screening: identification of individuals harboring K-ras mutations with the use of plasma DNA // Journal of the National Cancer Institute 2000, V.92: 11.

10. Juckett DA, Rosenberg B. Actions of cis-diamminedichloroplatinum on cell surface nucleic acids in cancer cells as determined by cell electrophoresis techniques // Cancer Res 1982, V.42 (9): 3565-73.

11. Laktionov PP, Dazard JE, Vives E, Rykova EY, Piette J, Vlassov VV, Lebleu B. Characterisation of membrane oligonucleotide-binding proteins and oligonucleotide uptake in keratinocytes // Nucleic Acids Res. 1999, V.27 (11): 2315-24.

12. Boom R., Sol C.J.A. Rapid and simple method for purification nucleic acids // J. Clin. Microbiol. 1990. V.28. P.495-503.

13. Virmani AK, Rathi A, Sathyanarayana UG, Padar A, Huang CX, Cunnigham HT, Farinas AJ, Milchgrub S, Euhus DM, Gilcrease M, Herman J, Minna JD, Gazdar AF. Aberrant methylation of the adenomatous polyposis coli (APC) gene promoter 1A in breast and lung carcinomas // Clin. Canc. Res. 2001, V.7 (7): 1998-2004.

14. Burbee, D.G.; Forgacs, E.; Zochbauer-Muller, S.; Shivakumar, L.; Fong, K.; Gao, В.; Randle, D.; Kondo, M.; Virmani, A.; Bader, S.; Sekido, Y; Latif, F.; Milchgrub, S.; Toyooka S, Gazdar AF, Lerman MI, Zabarovsky E, White M, Minna JD. Epigenetic inactivation of RASSFIA in lung and breast cancers and malignant phenotype suppression // J. Natl. Canc. Inst. 2001, V.93 (9): 691-699.

15. Kowara R, Golebiowski F, Chrzan P, Skokowski J, Karmolinski A, Awelczyk T. Abnormal FHIT gene transcript and c-myc and c-erbB2 amplification in breast cancer // Acta Biochimica Polonica, 2002, V.49 (2): 341-350.

16. Lonn U, Lonn S, Nilsson B, Stenkvist B. Prognostic value of erb-B2 and myc amplification in breast cancer imprints. Cancer, 1995, V.75 (11): 2681-2687.

17. Silva JM, Rodriguez R, Garcia JM, Munoz C, Dominguez G, Provencio M, Espana P, Bonilla F. Detection of epithelial tumour RNA in the plasma of colon cancer patients is associated with advanced stages and circulating tumour cells // Gut, 2002, V.50: 530-534.

1. Способ ранней диагностики заболеваний, связанный с нарушением функционирования генетического аппарата клетки, включающий забор крови, разделение собранной крови на плазму и клеточную фракцию, выделение внеклеточной нуклеиновой кислоты (ВНК), выявление специфической последовательности нуклеиновой кислоты методами амплификационного анализа с последующим анализом ПЦР-продуктов и составлением заключения о наличии или отсутствии детектируемых нуклеотидных последовательностей, отличающийся тем, что в качестве источника ВНК используют ВНК, связанные с поверхностью клеток крови, при этом фракцию клеток крови разделяют на эритроциты и лейкоциты, далее последовательно элюируют ВНК, связанные с клеточной поверхностью эритроцитов и лейкоцитов, из полученных элюатов выделяют ВНК, которые используют для выявления не менее двух известных специфических последовательностей нуклеиновой кислоты, связанных с определенным заболеванием.

2. Способ по п.1, отличающийся тем, что элюцию ВНК, связанных с поверхностью эритроцитов, осуществляют в две стадии: сначала элюцию осуществляют 10 объемами ФБР, содержащим 5 мМ ЭДТА при 4°С, с последующим осаждением клеток центрифугированием и сбором супернатанта, а затем элюцию проводят равным объемом 0,25% раствора трипсина при 4°С, с последующим добавлением ингибитора фермента, осаждением клеток центрифугированием и сбором супернатанта.

3. Способ по п.1, отличающийся тем, что элюцию ВНК, связанных с поверхностью лейкоцитов, осуществляют в две стадии: сначала элюцию осуществляют 10 объемами ФБР, содержащим 5 мМ ЭДТА при 4°С, с последующим осаждением клеток центрифугированием и сбором супернатанта, а затем элюцию проводят равным объемом 0,125% раствора трипсина при 4°С, с последующим добавлением ингибитора фермента, осаждением клеток центрифугированием и сбором супернатанта.

4. Способ по п.1, отличающийся тем, что ВНК из клеточных фракций крови выделяют преимущественно при помощи мелкодисперсного мешированного стекла в присутствии хаотропных солей.

5. Способ по п.1, отличающийся тем, что в качестве амплификационных методов используют полимеразную цепную реакцию, лигазную цепную реакцию, мультиплексную ПЦР.

6. Способ по п.1, отличающийся тем, что преимущественно осуществляют раннюю диагностику онкозаболеваний и патологий беременности.

Наша аюрведическая клиника в Гоа создала собственный уникальный набор анализов для клиентов. Данный набор позволяет определить наличие и уровень определенных заболеваний, подобрать наиболее оптимальное лечение в зависимости от полученных показателей и помочь клиенту избежать болезней в будущем. Наши лабораторные исследования дают картину физического состояния здоровья человека для того, чтобы врачи центра смогли подобрать корректные медицинские препараты и подходящую диету.

После первичной консультации с аюрведическим врачом, вам будет предложено пройти определенный набор анализов, подобранный индивидуально для вас.

Наша лаборатория проводит анализы крови, мочи, ренгтен, УЗИ и т.д.

1) ОАК (общий (развернутый) анализ крови)
2) ВСК (время свертыввания крови) и ВК (время кровотечения)
3) Уровень сахара в крови
4) ОХ (общий холестерин)
5) ТГ (триглицериды)
6) ФПП (функциональная проба печени)

Общий анализ крови проводится для того, чтобы узнать общее состояние вашего здоровья и обнаружить наличие какого-либо заболевания (например, малокровие, лейкемию, инфекционные заболевания). Общий анализ крови выполняется для того, чтобы:
1) Узнать общее состояние вашего здоровья
2) Диагностировать то или иное заболевание
3) Отслеживать состояние здоровья
4) Назначать адекватное лечение

При общем анализе крови исследуются:
-Белые тельца
-Красные тельца
-Уровень гемоглобина
-Гематокритное число
-Средний объем эритроцитов
-Среднее содержание гемоглобина в эритроцитах
-Гетерогенность эритроцитов по объему
-Тромбоциты

У человека в крови постоянно имеется немного тромбина, который находится в неактивном состоянии – протромбине. Протромбин образуется в печени человека и превращается в активный тромбин под воздействием тромбопластина и солей кальция в плазме. Время свертывания крови – 3-4 минуты. По прошествии 5-6 минут она полностью сворачивается и становится сгустком. Знать данные показатели необходимо для того, чтобы исключить/подтвердить наличие определенных заболеваний.

Все пищевые продукты, которые мы употребляем в течение дня, содержат в себе сахар в виде глюкозы. Если уровень сахар в крови повышен, то это вызывает известную всем болезнь – диабет. Нормальный уровень сахара в крови человека составляет 80-100 мг. Уровень сахара в крови регулируется особым гормоном, который называется инсулин – он вырабатывается в поджелудочной железе. Зачем делать такой анализ

  • Узнать о развитии болезни
  • Контролировать течение болезни/li>
  • Вовремя обнаружить повышение уровня сахара/li>

Согласно традиционной медицине, существует два типа диабета, но аюрведа утверждает, что диабет бывает 20 видов и каждый из них требует определенного лечения. Традиционная медицина назначает медикаментозное лечение диабета, которое имеет массу побоычных эффектов, однако аюрведа придерживается традиционных принципов лечения, которые не вызывают побочных эффектов и имеют гораздо большую эффективность.

Неразрывно связано заболеваниями сердечно-сосудистой системы.

  • 75-169 мг (для людей младше 20 лет)
  • 100-199 мг (для людей старше 21 года)
Читайте также:  Расшифровка анализа крови на гормон эстрадиол

Как подготовиться к анализу:
Не кушать и не пить ничего, кроме воды, 12 часов
Рекомендуется делать анализ не меньше, чем через три месяца после перенесенного сердечного приступа, операций, инфекционного заболевания, беременности.

Норма – менее 150 мг Триглицериды являются самым главным источником энергии для клеток. Поступление триглицеридов в организм человека происходит вместе с пищей, далее они синтезируются в жировой ткани, потом в печени и в кишечнике. Для диагностики атеросклероза, а также многих других заболеваний, используют анализ триглицеридов. Повышенный уровень триглицеридов может быть связан с ожирением, проблемами щитовидной железы, болезнями печени или генетическими заболеваниями. Высокий уровень триглицеридов может увеличить риск сердечного приступа и сердечно-сосудистых заболеваний.

Данный анализ проводится с целью выявления каких-либо печеночных заболеваний. Также данный анализ позволяет узнать состояние печени и ее функционирование. Согласно аюрведе, данный анализ позволяет подобрать правильное лечение для всех печеночных заболеваний.

Анализ крови на скорость коагуляции по Сухареву проводится для оценки плазменного фактора гемостаза.

Способность крови свертываться – это важная защитная функция. Гемостаз включает в себя способность крови находиться в жидком состоянии и реакцию на повреждение сосудов в виде остановки кровотечения за счет двух параллельных механизмов: образования тромба и свертывания крови.

Время свертывания по Сухареву — это определение промежутка времени, в течение которого фибриноген плазмы под действием ферментов полимеризуется и выпадает в осадок в виде нерастворимого фибрина-полимера. Этот тест позволяет оценить динамику свертывания, но не дифференцирует его механизмов.

Это исследование – важная часть комплекса анализов коагулограммы наряду с анализом на фибриноген, тромбоциты, протромбиновый индекс.

Определение времени сворачивания крови (ВСК) – обязательная проба перед операциями, для предупреждения критических состояний пациента, связанных с кровотечениями и тромбозами.

Пробы на коагуляцию проводят при таких заболеваниях:

  • Патологии внутренних органов;
  • Подозрение на наследственные гемостатические патологии;
  • Беременность;
  • Тромбозы, варикозное расширение вен;
  • Сердечная недостаточность;
  • Сахарный диабет;

Регулярно выполняют этот анализ и при терапии коагулянтами.

Важно! Беременные женщины должны ежемесячно проводить контрольные исследования коагуляции.

Забор крови для анализа свертываемости по Сухареву выполняют из пальца. Прибором, при помощи которого проводится тест, является капилляр из комплекта аппарата Панченкова.

После прокола первая капля крови удаляется ваткой. Затем в капилляр набирают небольшое количество крови (до отметки 30 мм). Каждые полминуты его наклоняют в разные стороны, перемещая столбик крови. Одновременно с момента помещения крови в капилляр для анализа на свертываемость крови по Сухареву запускается секундомер. С его помощью и фиксируют время, когда кровь полностью свернется.

Вначале кровяная масса, которая находится в жидком состоянии, перемещается свободно. С началом процесса образования сгустков ее движение замедляется, а к моменту полной коагуляции кровяная масса перестаёт двигаться. Данные секундомера на этот момент – и есть время коагуляции по Сухареву.

Если нарушена технология забора крови, при определении свертываемости можно получить неточный результат. Но такие факторы априори исключаются.

Гемостаз тонко реагирует и на текущее состояние организма пациента. Динамика свертываемости меняется в зависимости от приема пищи, медикаментов, эмоционального состояния. Именно эти факторы могут ситуативно изменить результаты. Поэтому пациенту стоит соблюдать простые правила подготовки к анализу:

  • За двое суток перейти на рацион, щадящий печень (исключить жирные, жареные, острые продукты, алкоголь);
  • Ничего не есть в течение 8 ч. перед анализом;
  • Воздержаться от курения;
  • Избегать стрессов и получения травм;
  • Сообщить врачу обо всех препаратах, которые он принимает или недавно прекратил принимать.

За полчаса до определения свертываемости можно выпить стакан обычной воды. Во время забора материала пациент должен быть спокойным. Волнение и учащенное сердцебиение (фактор опасности) запускает механизм выработки протромбиназы.

Важно! При подготовке ребенка часто возникают сложности, так как дети в лаборатории испытывают сильный эмоциональный стресс.

В норме первые сгустки становятся заметными уже через 30 секунд с начала манипуляций с капиллярной трубкой. Полное загустение наступает через 3-5 минут.

Норма по свертываемости крови грудных детей по Сухареву ниже (дольше), чем взрослых. У детей до года функции печени по выработке фибриногена неразвиты, поэтому норма свертываемости крови по Сухареву снижена. К году показатели коагуляции в анализах уже приближены к норме взрослого человека, но достигает полного соответствия только к периоду полового созревания.

Отклонение в анализе крови на свертываемость в любую сторону от нормы говорит о нарушении гемостаза и является поводом для расширенного обследования.

Время свертывания крови по Сухареву сокращается в результате ускоренного образования свертывающих факторов (кровяной протромбиназы) в организме пациента.

В организме кровяная протромбиназа может замещаться протромбиназой, вырабатываемой при повреждении тканей. Поэтому ускорение коагуляции может объясняться имеющимися повреждениями тканей (после операции, при ожогах, васкулите, туберкулезе) или быть нормальным состоянием при регулярных травмах (у спортсменов).

Важно! Высокую свертываемость можно определить у людей, ведущих активный образ жизни, связанный с регулярным травмированием (экстремальные виды спорта, тяжелый физический труд).

Укорочение времени свертывания требует профилактики, так как она угрожает появлением тромбов, развитием тромбоза и тромбоэмболии.

Гиперкоагуляция определяется при таких заболеваниях и состояниях организма:

  • Патологии печени;
  • Отравления;
  • Аутоиммунные заболевания;
  • Тромбофилия.

У женщин свертываемость может быть повышена на фоне длительного приема оральных противозачаточных препаратов.

Факторами, способствующими повышенной свертываемости, могут быть:

  • Облучение, онкологические заболевания;
  • Гиперфункция селезенки;
  • Обезвоживание организма, снижение pH;
  • Избыточное потребление сахара, углеводов;
  • Избыточный вес, длительный постельный режим, «сидячая» работа;
  • Заместительная гормональная терапия.

Такое состояние характеризуется длительностью кровотечений и возникает в результате:

  • Врожденного (гемофилия, болезнь Виллебранда) или приобретенного недостатка факторов, участвующих в протромбинообразовании (VIII, IX, XI);
  • Высокой концентрации в крови антиагрегантов, антикоагулянтов (гепарин, ацетилсалициловая кислота);
  • Лейкемии;
  • Тромбоцитопении;
  • Нарушения выработки печенью фибриногена при циррозе, гепатитах;
  • Нехватки плазмы в результате острых кровопотерь при быстром восполнении объема крови инфузиями;
  • Низкого гемоглобина, анемии;
  • Недостатка кальция, витамина К.

Важно! Замедленное свертывание у женщин в период беременности опасно сильными кровотечениями при родах.

Чтобы сократить длительность свертывания, пациенту назначают ингибиторы фибринолиза и растворения тромбов (аминокапроновая кислота, контрикал), прямые (фибриноген, тромбин) и непрямые (витамин К, викасол) коагулянты.

Часто таким пациентам показано переливание плазмы, которая содержит комплекс факторов коагуляции.

Изменения свертываемости могут считаться нормой, если их рассматривать в контексте текущего состояния организма человека. Отклонения от среднестатистических значений могут наблюдаться в таких случаях:

  • Женский организм в период беременности готовится к будущим родам, и для предотвращения кровопотерь скорость коагуляции повышается;
  • У пожилых людей скорость коагуляции снижается;
  • Пациенты, попавшие к врачу в состоянии истощения, показывают длительное время коагуляции крови;

Видео о механизмах свертывания крови:

Перед интерпретацией результатов врач проводит с пациентом беседу с целью получения информации о вероятных факторах, дающих объяснения ускоренному или замедленному свертыванию крови. Если таких данных нет, тогда врач имеет основания заподозрить патологию и назначить дополнительное обследование.

Девочки, симптоматика следующая. В прошлое вск заалели щеки, поднялась температура 37.7. Очень редкое подкашливание,соплей нет, но дыхание затруднено. Через 2 дня на руках ( а сейчас уже и на ногах) появилась сыпь, никак не беспокоит ребенка. Температура то поднимается, то сама уходит, сбивали только 2 раза, когда до 38.6 доходила, но выше не было, в основном до 38. Кровь вирусная. Инфекционист подозревает все от энтеровируса до мононуклеоза. Вчера сдали кучу крови, в среду узи,тогда же и результаты крови будут на. Читать далее →

Девочки подскажите пожалуйста влияет ли антибиотик на общий анализ крови, а точнее на эозинофилы и роэ. Пили цедекс 7 дней, закончили в вск, а в пн сдали кровь. Что смущает это резкое падение эозинофилов с 25 до 1. Возможно ли искажение такое, или он действительно просто снизился Читать далее →

И не от того что не хочу ходить по врачам, а от того что на работе из за этого напряг. Участок работы большой, ответственный, и когда нет задействованной боевой еденицы на рабочем месте — начальство недоволствует. Я всё понимаю- ну это же жизнь. Зачем все усложнять! На эту должность устроилась совсем недавно, в феврале 2012, при приеме обещала, что в ближайшее время не йуду в декрет. И тут как то неожиданно так вышло. . Чувство вины разрушающее, не хорошее чувство. Читать далее →

Наконец-то мы дома! Пролежали 10 дней, больше обычно в больнице не держат.Совсем не было времени написать про наши новости. А ведь мы еще подхватили там какой-то вирус (((.Спасибо всем за поддержку и пожелания выздоровления. Попробую написать для истории хронологию (получилось много, подробности пишу для себя).Пн. 9/06 — чт. 12/06В понедельник мы приехали с вещами и нас положили в изолятор. Там мы лежали три дня с температурой. (про это я писала)В четверг температуры весь день не было, и нас вечером перевели на. Читать далее →

Беременность с мужем планировали наверно года за полтора до. Сдали все анализы, пропили кучу пилюлек и вот на очередном приеме, моя Г. дала добро пытаться, хотя о собым энтузиазма она не испытывала, т.к. все боялась, что с моим гормональным фоном я буду пытаться долго и нудно)))) Я вск это дело послушала, покивала, но у меня-то был свой план! По группе крови (да-да я этим страдала))))))) моя подружка вычислила, что именно с июня месяца у нас с мужем получится девочка, мне. Читать далее →

Это пипец!Закончился карантин и наш поход,начавшийся в 9,закончился в 13!Без мужа я бы просто повесилась..А теперь по сути:))Со второй попытки мы сумели собрать анализ мочи))За ночь я спала часа полтора,муж может на час больше — колики зверствовали.Поэтому когда время шло,а Вареник упорно отказывался писать меня начало накрывать уныние(И я плюнула- пошла в ванну страть пеленки,а его положила рядом..Видимо помогло — нацедил-таки:)Ввалились мы в этот муровейник,быстренько сдали мочу и поскакали кровь сдавать..А там очередь -мама мояяяяяя!Благо прибежала сестра и сказала что. Читать далее →

Многие девочки часто спрашивают о исследованиях во время беременности. Могу предложить вот такую информацию, может кому- то пригодится. 1. Посещение ж/к: — постановка на учет в сроке 7 — 10 недель; — посещение в первом тримистре — не реже 1 раза в месяц; — во втором тримистре — 2 раза в месяц; — в третьем тримистре — 1 раз в десять дней. 2. Обязательные обследования: — измерение наружных размеров таза проводится однократно — при постановне на учет. Оно позволянт определить. Читать далее →

Пишу полный отчет о нашем пребывании в больнице. В основном для себя, на память. Не думаю, что кто-то еще будет читать этот длинный пост. Итак, пролежали мы с Камилем в больнице 10 дней (((. Как я уже писала, в четверг, 16 дек. после садика у Камиля поднялась температура до 39,1. В пятницу вызвали педиатра — она поставила диагноз Фолликулярная ангина. В пятницу-субботу температура почти не снижалась, еще на одном глазике начался конъюнктивит. Читать далее →

Здравствуйте,ребенку 9 месяцев,мы на гв.С рождения мучались животом-коликами.Родились 3620.сейчас вес 7900.Из прикорма едим каши безмолочные и безглютеновые и овощи,мясо,яйцо.До сих пор ребенка беспокоят газы,спит плохо-тк не может пропукаться,не понимаю почему так,почему много газов и они не отходят?Сдавали на дисбак в 1,5 месяца результат был такой:Увеличено количество:E.coli Lac(-), Enterococcus spp., КоагулазонегативныеСтафилококки. Снижено количество:Bifidobacterium spp., E.coli Lac(+), Lactobacillus spp.Не лечились ничем.Затем в 5 месяцев:Бифидобактерии 10 в 7 при норме 10 в 9-10 в 10Лактобактерии 10 в 5 при норме 10 в 8Кишечная. Читать далее →

Добрый день, уважаемые форумчане. Очень хотелось бы рассказать о своих впечатлениях об отдыхе в Паттайе. Я очень люблю Таиланд, очень по нему скучала, потому что не видела свою любимую «страну улыбок» больше 4 лет, пока подрастала моя маленькая дочка. И тут я решилась на отдых с 3,5 летней дочуней (с сыном в первый раз полетела в Тай, когда ему тоже было чуть меньше 4 лет). Первый раз я отдохнула так, как врагу не пожелаешь, отдых был испорчен практически с самого. Читать далее →

Сыну 4 месяца сдали кровь и были тромбоциты 688 при норме 300 ДК 50 минут. ВСК 3 минуты 50 секунд. Педиатр заметила только тромбоциты и мы пересдали анализ получили результат 388, сегодня нша врач пришла даже к нам домой когда заметила ДК и ВСК и сказала что пока пугать не будет но срочно ересдать эти показатели. Кто что может сказать по этому поводу очень переживаю так как сдавать только в понедельник и плюс ко всему появились высыпания на лице и. Читать далее →

Всем привет! Девочки, опять у меня какая-то беда( Год назад, сдав все стандартные анализы, мы с мужем перестали предохраняться. В первый цикл активного планирования месячные мои задержались, задержка была 10 дней при стабильном цикле. Тесты и анализ на ХГЧ беременности не показали, назначили дюфастон, после него пошли М. На след. цикл снова не предохранялись — произошла беременность, которая на 9 неделе замерла. Сделали чистку. Полгода врач беременеть не разрешала, потом сдали анализы — разрешила. Но никак не могли выйти на. Читать далее →

Вот уже мы почти на финишной прямой. Еще 3 дня, и останется всего четверть пути. Вчера сдала анализ на коагулограмму в Инвитро, пришли очень хорошие результаты. С утра была у гини, тоже все в норме: и кровь на гемоглобин, и анализ мочи. ОБмерили: окружность живота в положении лежа — 92 см (+3 см за месяц), вес — 63,2 кг (в норме), сердцебиение — 133-152 уд. / мин. Взяли мазок на флору. Направили на третий скрининг (запишусь на вск, как раз. Читать далее →

Завтра нам год и в связи с этим посетили поликлинику Педиатр, Рост 76, вес 9230 (получается за последние 2 месяца прибавка была всего 150), но педиатр сказала, что это нормально. а я чет переживаю. Невролог — все ок, назначила массаж (мышцы слабоваты). Явка в 1,5 года Хирург — все ок, назначила массаж и электростимуляцию (это по рекомендации ортопеда из Зацепина). Явка в апреле (после визито в ЦИТО) Окулист — вск ок. Явка в 2 года Осталось нам: 1. прикрепиться к. Читать далее →

В четверг ночью поднялась температура сначала 37.5 через 2 часа 38 обтерла влажной пеленкой, чуть позже спала до 37.5. Целую ночь мерила температуру, пробовала отсосать сопли, орет дурниной, не подпускает к носу. В пятницу были сопли немного, капала аквамарис. в субботу и вск и сегодня состояние здорового ребенка (надеюсь больше не будет соплей и темпы) Вчера заметила нижние десна около клыков припухшие сегодня отчетливо видны припухлости, вот почему ко рту не подпускает, не ест толком. Кстати, попали мы к гематологу. Читать далее →

источник